| Specific suggestions related to the items above |
| # | Response Date | Comment |
| 1. | Thu, 4/26/07 3:35 PM | PCR on mRNAs would be especially useful. |
| 2. | Thu, 4/26/07 7:29 PM | Keep up the spectacular work you are doing. |
| 3. | Fri, 4/27/07 12:08 AM | 1) UCSC browser recently added these "red" lines to alignments. No info on what those are. So more support for new features, or changed color schemes in alignments would be greatly appreciated.
2) There are too many tracks in the human genome browser. Need a way to consolidate them, otherwise we are spending time just hunting. For example, the Expression and Regulation tracks can be separated; Comparative Genomics can be consolidated by using a Phylogenetic scheme.
|
| 4. | Fri, 4/27/07 2:02 AM | Of late, tracks appear to be added indiscriminately without enough thought and support behind them. E.g., In human browser--"Old known genes"! How does one conceptually distinguish them from "UCSC genes"? A track really has to be a functionality or a feature--not just any database. |
| 5. | Fri, 4/27/07 2:55 AM | I join Genome ML. It's very nice that Genome's staff answer kindly. |
| 6. | Fri, 4/27/07 8:22 PM | It is very important to maintain links to the accession numbers in NCBI |
| 7. | Fri, 4/27/07 8:30 PM | fast = good |
| 8. | Fri, 4/27/07 8:53 PM | 1. Provide more descriptions of tracks.
2. Make it a priority to have previous tracks available on the latest genome annotation, e.g. structural variation, ENCODE appear on May 2004 but not March 2006 human assembly.
|
| 9. | Fri, 4/27/07 11:22 PM | editorial board interesting idea, proposal needs further explanation and discussion
outline goals 5 years out, where is browser going? do some parts mature and stabilize?
human completed 5 years ago, no timeline yet to identify reference genes? (separate a reference function from edgy research)
define a balanced longterm scientific agenda not driven by click counts, research trendis, or current staff interests
medical associations could all be resolved near-term, browser left stranded if too heavily invested there.
more focus on comparative genomics tracks, tools, alignments
more protein browser feature development, a bias towards transcription now
carry enough genomes and blats to achieve balance across time scales (short on early deuterostomes, protostomes, and pre-bilaterans).
more explanation of what tracks are, what they tell us, plain english how they are made, less computer-generated credits and off-site biblio
more support of unsupported genome-test tracks so that users know what they are using and can make constructive inputs to track developers
|
| 10. | Sat, 4/28/07 3:10 AM | Expand ChIP-chip and ChIP-sequencing. ChIP with Illumina sequencing is likely to compete strongly with ChIP-chip for large genomes, and this is likely to develop quickly during 2007. |
| 11. | Sat, 4/28/07 1:44 PM | It may be possible, I haven't seen a way, but it would be nice if there was a way to download the source sequences for the comparative genomics tracks from other species. This would be useful if the user would like to do something with the sequence from the other species, such as re-aligning it. This way you could get the not necessarily aligning, but presumably orthologous region of another species through the browser. |
| 12. | Sat, 4/28/07 9:15 PM | include option in BLAT search to restrict number of matches displayed in results list.
provide more background information for annotation tracks. |
| 13. | Sun, 4/29/07 2:46 AM | I am leery that genomic tools can discriminate between disease-causing and neutral variants in medical sequenciung projects. The mechanisms for these differences are not always genomic. Errors in assigning clinical status to such variants could lead to medical errors and even to lawsuits against the Browser. |
| 14. | Sun, 4/29/07 9:18 AM | Currently it is very difficult to create a local mirror of the UCSC infrastructure but with new data (i.e. a new genome, or own EST collection).
Unlike Ensemble and Wormbase, UCSC does not have an clear instructions for easy building of new databases.
|
| 15. | Sun, 4/29/07 1:35 PM | Be more responsive with updating the multiple alignments for new assemblies |
| 16. | Sun, 4/29/07 11:52 PM | To me, having all sequenced species in one place is very important - it allows me to quickly find what I'm looking for in an organism on which I haven't worked before. So I'd like fungi and plants (please, give us plants) more than any nifty new feature. |
| 17. | Mon, 4/30/07 4:24 AM | Don't follow Ensembl! Ensembl looks like all the biological data has been given to computer scientists/programmers who have no idea what the data means, but are very keen on producing multiple different ways of mining it/displaying it, even if the methods biologically make no sense. I have gone from using Ensembl occasionally to actively recommending against using it in my role as a 'enabler'. |
| 18. | Mon, 4/30/07 6:13 AM | Please add S. pombe genome data. |
| 19. | Mon, 4/30/07 7:28 AM | The speed of the site is the most crucial issue. Very often it is impossible to use the UCSC site because it is too slow. |
| 20. | Mon, 4/30/07 9:16 AM | More detailed information about adding custom tracks and custom sessions. |
| 21. | Mon, 4/30/07 5:45 PM | - Make In-Silico PCR search RNAs: not sure about RNAs not matching the genome, but definitely searching matching RNAs across splice sites would be great.
- Establish an editorial board to more tightly control which tracks we support: not sure about this. Could be good to allow scientific review of useful tracks that would not become published in any way... these could even become citable in this fashion.
- Update the appearance of the browser website: Not so important, with the following exception: the fishbone display is great for interactive work, but not for figures in publications. An alternative display would be great for that. |
| 22. | Mon, 4/30/07 9:48 PM | If you have any notion of what genes are not likely real or have little evidence of being true, it would be good to separate those out in another track, or have option of not displaying or downloading them. |
| 23. | Mon, 4/30/07 9:52 PM | speed speed speed would be my priority; an editorial board to regulate the number and quality of tracks that are available (at least by default) is a good idea. |
| 24. | Mon, 4/30/07 10:53 PM | Quicker and more streamlined publication of ENCODE functional genomics data. Better UI for searching through functional genomics data. Tools for meta-analysis.
|
| 25. | Tue, 5/1/07 4:02 AM | What about plants |
| 26. | Tue, 5/1/07 11:05 AM | nothing special |
| 27. | Tue, 5/1/07 11:19 AM | Change the policy on genomic coordinates. The 0-based start-coordinate is often very confusing and GB is the only site that has introduced it. |
| 28. | Tue, 5/1/07 12:31 PM | some online how-to's would be helpful, instead of just the traditional help-file structure. e.g.:
how to: given SNP rs#'s, how to get a table to export the nearest gene to that SNP.
given a list of genome coordinates in one build, how to easily get a table to export the coordinates in another build.
etc. |
| 29. | Tue, 5/1/07 3:33 PM | With regard to the C. elegans, Drosophila, yeast browser updates - shouldn't they all stay updated? |
| 30. | Tue, 5/1/07 7:10 PM | can you add the known fusion trascript sequences?
eg. bcr-abl etc |
| 31. | Wed, 5/2/07 5:58 AM | It would be good to see in the main window polymorphisms such as SNPs already in different colours differentiation between those with data (frequency) and those without (and maybe even linkage) - helps in selection. |
| 32. | Wed, 5/2/07 7:23 AM | I'm a user of the ENCODE browser |
| 33. | Thu, 5/3/07 12:40 PM | It would be helpful to expand the SNP panels to include the illumina 550K chip in addition to the illumina 300K chip |
| 34. | Fri, 5/4/07 9:17 AM | What I would very , very muxh appriciate, is more tracks on copy number variations. Maybe diferent tracks for different platforms (SNP, non-SNP oligo, BAC tiling), and also info on etnic differences. |
| 35. | Fri, 5/4/07 4:30 PM | index to help |
| 36. | Fri, 5/4/07 7:14 PM | We would very much like to see c elegans browser updated to WS170 sequence version and annotations |
| 37. | Fri, 5/4/07 7:22 PM | In-silico "RT-" PCR for RNA would be great! |
| 38. | Fri, 5/4/07 9:55 PM | Updating the genome builds (esp. c elegans) to the most recent freezes is most important, especially when they are being used for bioinformatic analysis and the current supported build is over 3 years old. |
| 39. | Sat, 5/5/07 12:57 AM | Enable minus strand to be displayed 5'->3' (I know that I can display the complementary sequence but I can't seem to find a way to display it 5'->3') Maybe I'm just daft.
Regarding the conservation track- It would be nice to select from different levels of conservation for the histogram (i.e. more species but have ability to limit some from contribution to histrogram). Again if it can already do this then ignore this and I'll keep playing with it.
Can more fungal genomes be added? |
| 40. | Sat, 5/5/07 1:57 AM | Don't go too many directions, you might dilute the excellence of what you have. |
| 41. | Sat, 5/5/07 1:36 PM | I have the changed expression information of a certain genomic locus(about 100 genes), how can I add this information to each genes? or how can quickly search a gene among 100 genes in a map of UCSC Genome Browser?
|
| 42. | Sat, 5/5/07 4:23 PM | It would be helpful to have user-selected options to control what subsets of genes are displayed (predicted v. "real"). In addition, it would be very useful to have a control that allowed or prevented all genbank entries from being displayed. Usually the short list is fine; however, in some cases it leaves out the uncommon (and interesting) ESTs. |
| 43. | Sat, 5/5/07 7:02 PM | Having a set of coding sequence alignments would be very valuable. i.e. For these ~10,000 genes there is a one to one relationship between human, chimp, macaque, mouse, rat, dow, cow, cat. Here is the most inclusive gene model and its ortholgous sequences from the other species. Align at the amino acid level, but show the nucleotide squence for dN/dS type calculations. This is hard to do, but have a "standard" set of ORF alignments would be extremly valuable. |
| 44. | Sat, 5/5/07 8:18 PM | make conservation alignments downloadable in a common format to submit to RNalifold for example |
| 45. | Sat, 5/5/07 8:34 PM | it is very hard for someone with no training to understand what all the tracks are / mean. |
| 46. | Sun, 5/6/07 2:51 AM | 1. Information regarding exons - intron numbers, like the EC gene database.
2. blat that enable mRNA sequences to run
3. very inportent -
the effects of alternative splicing
|
| 47. | Sun, 5/6/07 3:53 AM | good |
| 48. | Sun, 5/6/07 1:27 PM | Idea about inclusion of data of genome wide association and linkage analysis is great. In addition, gene association studies would be great.
In case you do, I would go for few genes, but complete rather than a lot of genes with incomplete information. |
| 49. | Sun, 5/6/07 9:45 PM | Please update ENCODE project dataset. |
| 50. | Mon, 5/7/07 5:32 AM | side by side tracks for orthologous regions between different species |
| 51. | Mon, 5/7/07 8:17 AM | When I first started using UCSC I found the genome alignment information rather difficult to interpret. Maybe there is a more to give options of what info will be displayed and an account of what it means (for the non experts) |
| 52. | Mon, 5/7/07 9:29 AM | how can I contact the responsible person for more gene expression data in the mouse? |
| 53. | Mon, 5/7/07 11:48 AM | Add a track to display all the human CNV's found in the Hap-map study |
| 54. | Mon, 5/7/07 12:58 PM | All pictures/colors/etc should be explained somehow in the webpage so that user would know what for example a red SNP vs. black SNP mean in the genome picture.
Also gene expression data is hard to interpret. What do the different colors mean. Also some of the dark colors are hard to interpret: is it red or green... |
| 55. | Mon, 5/7/07 1:32 PM | Very important with a clear distinction between polymorphisms, unknown variants and pathogenic variants. Integration of copynr. variations. |
| 56. | Mon, 5/7/07 2:42 PM | Please keep annotation of rat, mouse and human up to date. Your rat assembly is the Nov 2004 assembly used to make RGSC v3.4. NCBI uses RGSC v3.4 also but they have July 2006 reannotation of the rat genome. It is not clear if your Browser uses that new info.
Your mouse genome is based on a Feb. 2006 assembly, but NCBI has a May 8 2006 Build 36 that seems to be newer.
Your human assembly is from March 2006, but there is a new assembly Build 36.2 from April 2007 |
| 57. | Mon, 5/7/07 2:44 PM | A track with known disease-causing mutations would be great. It would be hard, though; HGVbase is just a start. |
| 58. | Mon, 5/7/07 3:48 PM | definitely expand the annotations for tracks. i often don't completely understand what the tracks are telling me. diagrams in these explanations would be useful. |
| 59. | Mon, 5/7/07 6:26 PM | I love this site, but the graphics are dated. I would appreciate if the browser was a little better to navigate through CNVs and SNPs within genes. |
| 60. | Mon, 5/7/07 7:05 PM | Make the download tables download section less mysterious. I found it very effective, but difficult to know what's possible ahead of time.
|
| 61. | Mon, 5/7/07 9:06 PM | For exon/intron/codon info I usually rely upon Ensembl since they have a better view of the information. Much of the stats on the proteome browser are not useful to me and I would much rather see conserved domains and their boundaries in the amino acid sequence and in the exon/intron structure.
When I am zoomed out to 100-200 kb to fully view some genes, it becomes very difficult to see coding and noncoding exons which the browser represents as tall and short bars. Increasing their size or color coding would help.
|
| 62. | Mon, 5/7/07 10:09 PM | If you can cure a bit more the bovine genome |
| 63. | Mon, 5/7/07 10:34 PM | Generally; experimentally verified infromation should be distinguished from hypothetical or purely informatic inferences where ever possible. Perhaps a set of reviewers/curators for each track you decide to support |
| 64. | Mon, 5/7/07 10:36 PM | Give more examples and documentation on how to make the most of custom tracks. |
| 65. | Tue, 5/8/07 1:11 AM | Please display both DNA strands. |
| 66. | Tue, 5/8/07 1:27 AM | n/a |
| 67. | Tue, 5/8/07 2:29 AM | I have given low scores to "display results of genome association studies and linkage studies" because I just think that displaying this kind of information on the GB may be too difficult and of too little value without access to the underlying data. The MBI mouse QTL mapping data is of marginal value because 1. the track does not provide LOD scores, 2. there is almost no practical way to backtrack to the orginal maps. GeneNetwork and other sites do this much better for mouse and rat and are linked to the GB. similar tools for |
| 68. | Tue, 5/8/07 5:13 AM | I would much rather see a way to "tease out" high quality information that is experimentally verified than a large "mish-mash" of bioinformatic screens (I can go to EBI for that)... overall I have been quite happy with the UCSC genome browser and have found fewer errors in it than in Ensembl, which I feel takes the "mass information approach" at the expense of quality or evaluation of the information (i.e., annotation appears poor when compared to UCSC, and I can get to the original data much more easily on the UCSC genome browser). |
| 69. | Tue, 5/8/07 8:36 AM | Produce more attractive outputs and user menus - i.e like hapmap website. |
| 70. | Tue, 5/8/07 9:45 AM | Update genome data (in Blat and Genome Browser)about other organisms such as Apis mellifera. |
| 71. | Tue, 5/8/07 3:13 PM | Relating to adding species to the conservation track, it would be great if we could toggle them on and off, in other words if I want to look at human, elephant and chicken only, I can toggle the rest off, etc. |
| 72. | Tue, 5/8/07 3:15 PM | Prioritize the addition of more data above any major interface update, and certainly above editorial board curation. |
| 73. | Tue, 5/8/07 4:30 PM | DIRECT ACCESS TO VISTA TRACKS FROM USCS SITE |
| 74. | Tue, 5/8/07 6:06 PM | it would be great to be able to align translated refseqs across species or across gene families. |
| 75. | Tue, 5/8/07 6:23 PM | none |
| 76. | Tue, 5/8/07 9:06 PM | The speed of the site is terrible. Which I suppose really speaks to its usefulness and importance to the community.
|
| 77. | Tue, 5/8/07 9:16 PM | Updating the C. elegans data in the browser is extremely important. As a worm researcher, I would like to use UCSC more often, but am limited by the severly out-of-date C. elegans information |
| 78. | Wed, 5/9/07 6:37 AM | Ability to retreive multiple sequence information (ex: Submit a list of accession numbers / gene names and retrive genomic or protein sequence information). |
| 79. | Wed, 5/9/07 6:42 AM | make the 'custom track' function more user-friendly (maybe using a different interface) |
| 80. | Wed, 5/9/07 6:43 AM | Better visualization of alternative splicing events, such as a track of "annotated" cassette exons, alt. 5'/3'ss, retained introns, etc... |
| 81. | Wed, 5/9/07 10:00 AM | hi
i like the browser as a genome knowledge base, if you want to increase your presence in the expression or mutation fields then a linked sister site may be a better idea to start the page from getting bloat/feature creep. |
| 82. | Wed, 5/9/07 12:57 PM | Although the user interface was very innovative at first, it's getting a bit obsolete. I also miss some integrated tools in your service, which makes me need the help of other sites. |
| 83. | Wed, 5/9/07 1:45 PM | We have made a track to display human eye-specific SAGE results (EyeSAGE) that I think works quite well. You can see it at:
http://eyebrowse.cit.nih.gov/
|
| 84. | Wed, 5/9/07 7:39 PM | speed has been a major probem for the past several months. It may take over 1 minute to change to a different "page". It did not used to be this bad. I have the same time problem whether I access from home or work, whether it is during the day or at night, or during the week or weekend. |
| 85. | Wed, 5/9/07 8:09 PM | The user guides could use some updating, there's a lot of info there, it is just hard for a novice to get at... the site as a whole though is a fantastic resource, thanks! |
| 86. | Wed, 5/9/07 11:00 PM | update browser every 6 months |
| 87. | Thu, 5/10/07 12:29 AM | The speed can be kind of frustrating for power users. It's certainly not the slowest site i've seen , but especially when you're trying to scroll around a region, it can be slow. Wow, what about live AJAX scrolling along the chromosome, that would be cool eh?! And very useful! In any case, it's an incredible product, but anything you could do to make it faster or easier to scroll/zoom around would be great!! The genome browser staff is INCREDIBLY helpful! |
| 88. | Thu, 5/10/07 5:07 AM | keep it more up to date (UCSC genome versions < ensembl versions)
keep it simple/easy to use |
| 89. | Thu, 5/10/07 7:23 AM | if you put up QTLs and so on, it would be useful to have other sorts of genetic loci, such as KOs and other induced or natural alleles, etc, visible at the same time |
| 90. | Thu, 5/10/07 4:01 PM | 1) Use more than one predictive program for the presence of enhancers/transcription factor binding sites and highlight those predictive by these separate algorithms.
2) The display of 7X Reg Potential needs to be explained more clearly.
3) What do "Net" and "Chain" mean? Don't understand their usefulness. |
| 91. | Thu, 5/10/07 5:17 PM | I think adding microarray data would be useful
Making the going back and forth between genome borwser and proteaome browser would be useful.
|
| 92. | Thu, 5/10/07 6:23 PM | It will be crucial to add additional species to the conservation track, and to add additional expression, protein-protein and CHIP/CHIP data. In addition, it would be helpful if in-silico PCR did search RNAs, and if we could take alternative spliced products into consideration with the proteome browser. |
| 93. | Thu, 5/10/07 8:14 PM | at least with Safari, the longer I use (i.e., the more views visited) the Genome Browser, when I quit the program, the longer it take to quit. This suggests that some cache or memory is being constantly written to without being pruged (particulary with views of vrey large spans with lots of data). Fixing this "memory leak" might be a great leap in usability. |
| 94. | Thu, 5/10/07 9:23 PM | I would like to see more information on pseudogenes, could be based on NCBI NG_~ RefSeqs. I would like to see more genes' variations. |
| 95. | Thu, 5/10/07 9:56 PM | It is really fast! but I suppose even faster would be better.
I would like a bit clearer and easier jumps to matching genes in other species. |
| 96. | Fri, 5/11/07 9:02 AM | In my opinion the speed of the browser is really a critical point to improve !!!!! Otherwise this browser is an excellent tool. |
| 97. | Fri, 5/11/07 10:00 AM | It would be useful if we could choose which species we add to te conservation track,instead of include always all of them |
| 98. | Fri, 5/11/07 10:37 AM | In my opinion the Known Genes set has to be evaluated! There are so many sequence variants listed which obviously do not exist and are misleading to unexperienced user (I guess). |
| 99. | Fri, 5/11/07 10:37 AM | - |
| 100. | Fri, 5/11/07 12:43 PM | No suggestion |
| 101. | Fri, 5/11/07 4:41 PM | conservation track: it should be more configurable, so if i want to see 25 speices, i can, if i only want to see 5, then i can.
protein browser is basically non-existant. it should have multiple alignments, xtal structures, domains, links to-from the genome etc.
there should be better ways to display microarray type data, that make it clear/easy to understand what is going on.
you should have the blat server(s) be more open/friendly about searching the genome, mrna's, etc. i see no reason it shouldn't have filters for types of sequence, kind of like ncbi's blast has. you should also have other search tools running alongside blat: blast is a good one, since it has aspects that make it more sensitive.
medical studies are important to support. kind of goes along with making better ways to display microarray data.
known genes. have a track that is hypothetical genes then.
|
| 102. | Fri, 5/11/07 4:45 PM | I think this is a terrific data base, just keep at it and I hope you get the funds to do it. |
| 103. | Fri, 5/11/07 5:15 PM | As much functional data as possible to better complement the available genomic information. |
| 104. | Fri, 5/11/07 8:20 PM | A microRNA gene track would be really great. |
| 105. | Sat, 5/12/07 9:11 AM | Redoing the interface can take alot of time and the end product may look nicer but be harder to use. If its not broke, dont fix it! |
| 106. | Sat, 5/12/07 2:40 PM | Add more ncRNA families and their expression data. |
| 107. | Sun, 5/13/07 10:00 PM | It would be wonderful if we could use blat for mutation screening in the same manner as nbci's pariwise blast. The results line up with exon translation information (amino acids). To see a quick example, blast the below sequence at:
http://hibm.org/hrg/pages/blast/gne-blast.php
>GNE:E12
GTCCTGGCCAGTCACTATATCCACATTGTCAAAGACGTCATTCGCCAGCAGGCCTTGTCC
TCCGTGCAGGACGTGGATGTGGTGGTTTCGGATTTGGTTGACCCCGCCCTGCTGGGTGCT
GCCAGCACGGTTCTGGACTACACAACACGCAGGATCTACTAGACCTCCAGGAACAGACAT
GGACCTTCTCTCCAGAGCTCCTGAGTGGAATCAAGTTCTTGTCTTTAGGATGACCGTTTC
TTAACAATCAAATCTGGTAT
|
| 108. | Mon, 5/14/07 10:28 AM | Disease and morbidity data from OMIM could be integrated in UCSC, a similar version like MapView of NCBI. |
| 109. | Mon, 5/14/07 6:20 PM | Ability to see SNPs directly above the CODING parts of the Genes as well as the Amino Acid variations and polymorphism within the CODING regions. |
| 110. | Mon, 5/14/07 7:20 PM | More detailed user guides would be useful to me, particularly customizing tracts. |
| 111. | Mon, 5/14/07 8:08 PM | The browser gets very slow when user adds large custom tracks. Also, human browser is generally faster than other species, especially with Blat - any way to improve other species? |
| 112. | Mon, 5/14/07 10:35 PM | I would like to see known and putative transcriptional factors binding sites |
| 113. | Mon, 5/14/07 10:44 PM | none |
| 114. | Tue, 5/15/07 1:56 AM | Linking results of genome-wide association, candidate gene association and linkage studies to the Browaser would be enormously helpful, allowing people who have pulled out a gene (using either one of these techniques, or a functional assay) to see immediately which diseases or traits it might be associated with. More gene expression and conservation data would also be helpful for quickly obtaining functional information on a gene. |
| 115. | Tue, 5/15/07 2:29 AM | GOOD |
| 116. | Tue, 5/15/07 3:13 AM |
|
| 117. | Tue, 5/15/07 5:56 AM | Update the D. melanogaster information. One notable problem is that the genomic coordinates for genes on the UCSC browser do not match the updated coordinates on FlyBase. |
| 118. | Tue, 5/15/07 1:54 PM | It would be nice if UCSC supported the same set of model organisms as NCBI, including plants. |
| 119. | Tue, 5/15/07 3:26 PM | none |
| 120. | Wed, 5/16/07 11:53 AM | none |
| 121. | Wed, 5/16/07 12:05 PM | Update cow browser |
| 122. | Wed, 5/16/07 6:00 PM | Display cancer genomic polymorphisms is very essential. |
| 123. | Thu, 5/17/07 10:51 AM | 1) allow users to change the order in which multiple custom tracks are shown on the screen (am I right that currently the only way to do it is to reload them in a different order? if not then this feature is not obviuos)
2) increase at least 3-fold the expiry period for custom tracks
3) a fast in silico RT-PCR protocol would be really handy! |
| 124. | Thu, 5/17/07 2:12 PM | RNA-based in silico PCR will be a key improvement! |
| 125. | Thu, 5/17/07 2:58 PM | You people do an awesome job. If you opted to do nothing, you'd be doing fine! |
| 126. | Thu, 5/17/07 5:04 PM | You are my favorite browser. |
| 127. | Thu, 5/17/07 6:17 PM | The format and design are great. please don't change |
| 128. | Thu, 5/17/07 6:59 PM | none |
| 129. | Fri, 5/18/07 7:26 PM | need tf sites and if not there yet histone sites |
| 130. | Fri, 5/18/07 8:53 PM | Your alignment should of affymetrix probesets should be based on the sequence of those probes that make up that set. If I blat the actual sequence of the probe(s) they don't line up where you show them to, or only at a very small region of what you show.
Probes sequence info can be freely downloaded from affy's website. |
| 131. | Sun, 5/20/07 10:27 AM | It would be useful to be able to browse the many recentely sequences insect genomes at UCSC. Although Flybase has improved, their browser is not as useful as the UCSC browser, in particular lacking comparative aspects (chains, nets). |
| 132. | Sun, 5/20/07 7:51 PM | Please map dog 2M SNP to both canfam1 and canfam2 |
| 133. | Mon, 5/21/07 5:45 AM | ok |
| 134. | Mon, 5/21/07 8:29 AM | Overall I'm happy with the browser. I like it as is. I'm afraid to suggest any modifications cause they are to an extent the side problems and the browser could be overloaded. Still some features such as cancer/normal polymorphisms could be probably introduced with not much stress.
As for the mirror: unfortunately ;-(((, we have no mirror site in Russia I believe. Still the speed is great and for the single-gene browsing it is very acceptible. |
| 135. | Mon, 5/21/07 7:05 PM | Re: editorial board. Although I selected no opinion (I think this is probably a decision driven by internal interests), I have concerns that such a board might result in the scaling back of available content. This might make it more supportable, but one of the reasons I choose UCSC over other browsers is the bredth of data types available. |
| 136. | Tue, 5/22/07 5:25 PM | N/A |
| 137. | Tue, 5/22/07 8:13 PM | have more detailed online tutorials |
| 138. | Tue, 5/22/07 8:17 PM | I don't know the capacities of the genome browser group, but this seems to be a lot to be maintained by one group. Therefor, I think the best strategy for the proteome & domain stuff would be to establish efficient links to other databases.
Concerning the conservation tracks: it would be good to get from the browser to the alignments with a couple clicks.
Also before more expression data are added, a different displaying system would be nice. Because it is unclear how to compare intensities across studies, I suggest to reduce this data to the affy absent/present calls, which are relatively robust. |
| 139. | Wed, 5/23/07 12:03 AM | always have the genes read left to right, even if they are not that way on the chromosome |
| 140. | Thu, 5/24/07 3:18 PM | "Develop tools to help discriminate between disease-causing and neutral variations for medical sequencing projects" This is extremely lofty, with the exception of a subset of alleles. For instance, the D1241E of F8 has been sited as a hemophilia causing mutation and a QTN for variation in non-coagulopathic populations. |
| 141. | Thu, 5/24/07 7:51 PM | The |
| 142. | Fri, 5/25/07 12:33 AM | Update the bovine genome build
|
| 143. | Fri, 5/25/07 6:50 AM | Expand In silico PCR |
| 144. | Fri, 5/25/07 3:49 PM | better/easier identification of exons and introns |
| 145. | Sun, 5/27/07 1:30 PM | I came to site to find out which proteins are transcription factors for which genes - very hard to find. |
| 146. | Tue, 5/29/07 5:19 AM | add track of conserved non-coding, Expression tags in conserved regions |
| 147. | Tue, 5/29/07 6:39 PM | Overall this has been a fantastic tool. See below for other suggestions. |
| 148. | Wed, 5/30/07 8:25 AM | Only add data that is of high quality. |
| 149. | Wed, 5/30/07 11:25 AM | Make it easier to see ortholog alignments and protein variant alignments |
| 150. | Thu, 5/31/07 3:33 AM | Discrimination between mutations and neutral polymorphisms would be very useful, rather than having to switch between sites while analysing data. |
| 151. | Thu, 5/31/07 1:32 PM | Don't change the look! It works! It looks classy and clean. Don't make it messy and weird like Ensembl. |